ID: 1077392417_1077392427

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1077392417 1077392427
Species Human (GRCh38) Human (GRCh38)
Location 11:2306276-2306298 11:2306309-2306331
Sequence CCCTCCGGCCTCTCCCCTAGCTG CAGGAAATGAAAGAGCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 286} {0: 1, 1: 0, 2: 2, 3: 33, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!