ID: 1077412054_1077412071

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1077412054 1077412071
Species Human (GRCh38) Human (GRCh38)
Location 11:2408209-2408231 11:2408257-2408279
Sequence CCAAGACCCCTGGAGGGATGGAA CCCAGGTTTCTCCTGGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 197} {0: 1, 1: 0, 2: 0, 3: 26, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!