ID: 1077414005_1077414015

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1077414005 1077414015
Species Human (GRCh38) Human (GRCh38)
Location 11:2416079-2416101 11:2416120-2416142
Sequence CCGGGGCACAGGGTCCCCAAAGG GGAAACGGGAACTTCACGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 272} {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!