ID: 1077414525_1077414530

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1077414525 1077414530
Species Human (GRCh38) Human (GRCh38)
Location 11:2418501-2418523 11:2418519-2418541
Sequence CCAGGGGGCCTCAGCCAGGCCCC GCCCCTACCTCCAAGGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 631} {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!