ID: 1077423960_1077423968

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1077423960 1077423968
Species Human (GRCh38) Human (GRCh38)
Location 11:2465847-2465869 11:2465880-2465902
Sequence CCTGGAAGGCCATTTGGAGCCTG AGGAGCTGTGTGCTGCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 181} {0: 1, 1: 0, 2: 5, 3: 34, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!