ID: 1077424878_1077424890

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1077424878 1077424890
Species Human (GRCh38) Human (GRCh38)
Location 11:2470621-2470643 11:2470665-2470687
Sequence CCGCACATCCATCATGGCCCTGA TGGGGTTCCCTCGGCCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 203} {0: 1, 1: 0, 2: 15, 3: 87, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!