ID: 1077433746_1077433750

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1077433746 1077433750
Species Human (GRCh38) Human (GRCh38)
Location 11:2528411-2528433 11:2528430-2528452
Sequence CCTGCTGGTGTCCCAGCAGCAGC CAGCCCCCACCCCAGGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 385} {0: 1, 1: 1, 2: 15, 3: 146, 4: 1006}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!