ID: 1077440660_1077440664

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1077440660 1077440664
Species Human (GRCh38) Human (GRCh38)
Location 11:2567235-2567257 11:2567268-2567290
Sequence CCTTTAGTTCACCTTTGGAACTT CTGCAAATACAGATGAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135} {0: 1, 1: 0, 2: 1, 3: 28, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!