ID: 1077444061_1077444076

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1077444061 1077444076
Species Human (GRCh38) Human (GRCh38)
Location 11:2582207-2582229 11:2582250-2582272
Sequence CCGTGTGCACCTGCCTCTCTGTC CCTGCCCGGGGGTGGCCATGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 45, 4: 533} {0: 1, 1: 0, 2: 1, 3: 27, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!