ID: 1077445393_1077445399

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077445393 1077445399
Species Human (GRCh38) Human (GRCh38)
Location 11:2588296-2588318 11:2588327-2588349
Sequence CCTGTGCTGGAATGTTCCCCCAG ACAGCCTGCTCCCTCACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 164} {0: 1, 1: 0, 2: 0, 3: 24, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!