ID: 1077457567_1077457579

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077457567 1077457579
Species Human (GRCh38) Human (GRCh38)
Location 11:2690058-2690080 11:2690105-2690127
Sequence CCTGCTTCTGTCTGGGCTGAAGG GGGGTTAGAACTGGGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 262} {0: 1, 1: 0, 2: 2, 3: 19, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!