ID: 1077457966_1077457976

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077457966 1077457976
Species Human (GRCh38) Human (GRCh38)
Location 11:2692291-2692313 11:2692330-2692352
Sequence CCTGCTTCCCTCCATCCCTATTG CCACCATTTCTCTGTACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 511} {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!