ID: 1077458523_1077458525

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077458523 1077458525
Species Human (GRCh38) Human (GRCh38)
Location 11:2695771-2695793 11:2695824-2695846
Sequence CCTACTTTCTAATGCTTCTCCTA TCTCTGATAACTGATTAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 356} {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!