ID: 1077475852_1077475864

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077475852 1077475864
Species Human (GRCh38) Human (GRCh38)
Location 11:2790131-2790153 11:2790166-2790188
Sequence CCCTCAACCTGCCACAGAGACAG GCCACTGGGTGATGGGACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 324} {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!