ID: 1077491809_1077491829

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077491809 1077491829
Species Human (GRCh38) Human (GRCh38)
Location 11:2864431-2864453 11:2864483-2864505
Sequence CCATCCACCTTCCCCTCAGGGTG GGTACTCAAGGCCCACCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!