ID: 1077495327_1077495344

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1077495327 1077495344
Species Human (GRCh38) Human (GRCh38)
Location 11:2884385-2884407 11:2884422-2884444
Sequence CCCGGCCGCGCCCGGGGAGGGGC GCGAAAACTGCGCTCCCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 498} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!