ID: 1077495331_1077495346

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1077495331 1077495346
Species Human (GRCh38) Human (GRCh38)
Location 11:2884395-2884417 11:2884432-2884454
Sequence CCCGGGGAGGGGCTCCCGCGGCC CGCTCCCGGGGGGTCGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 330} {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!