ID: 1077515948_1077515961

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077515948 1077515961
Species Human (GRCh38) Human (GRCh38)
Location 11:3002343-3002365 11:3002374-3002396
Sequence CCTTGGCCAGGCCTTCCCTGCAC AGAAGGGCCTGGCAGGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 506} {0: 1, 1: 0, 2: 6, 3: 32, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!