ID: 1077521276_1077521279

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077521276 1077521279
Species Human (GRCh38) Human (GRCh38)
Location 11:3036559-3036581 11:3036594-3036616
Sequence CCATGCACTATGGGTGGGAATGT CCACTGCAGAAACAATACGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 13, 3: 55, 4: 269} {0: 1, 1: 0, 2: 1, 3: 10, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!