ID: 1077522894_1077522906

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077522894 1077522906
Species Human (GRCh38) Human (GRCh38)
Location 11:3046711-3046733 11:3046757-3046779
Sequence CCAGAAAACAGCACTAAACCTGC CCCACAGCCACAGGAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 430} {0: 1, 1: 1, 2: 6, 3: 89, 4: 1199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!