ID: 1077522901_1077522910

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1077522901 1077522910
Species Human (GRCh38) Human (GRCh38)
Location 11:3046735-3046757 11:3046769-3046791
Sequence CCCACATGAAGGTGGAGGAGTGC GGAGGAGCTGGGCCACCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142} {0: 1, 1: 0, 2: 4, 3: 46, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!