ID: 1077527231_1077527239

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1077527231 1077527239
Species Human (GRCh38) Human (GRCh38)
Location 11:3074528-3074550 11:3074569-3074591
Sequence CCTTATAAGAAGAGTGACACAGG GGGAGAAGGTCATGTGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 38, 3: 203, 4: 917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!