ID: 1077530659_1077530672

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1077530659 1077530672
Species Human (GRCh38) Human (GRCh38)
Location 11:3093342-3093364 11:3093383-3093405
Sequence CCACACCCCTTCCCTCCATCTGT TCTGCCACCAGGGGTGCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 291, 4: 1587} {0: 1, 1: 0, 2: 1, 3: 16, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!