ID: 1077530673_1077530683

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1077530673 1077530683
Species Human (GRCh38) Human (GRCh38)
Location 11:3093387-3093409 11:3093413-3093435
Sequence CCACCAGGGGTGCACCAGGCCTG TCCCTGCCAGGGACATCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 264} {0: 1, 1: 0, 2: 4, 3: 25, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!