ID: 1077532081_1077532089

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1077532081 1077532089
Species Human (GRCh38) Human (GRCh38)
Location 11:3102063-3102085 11:3102091-3102113
Sequence CCCCTGGAAGCCGGCCCTCGGGG CTTGCCCCTGCCTGCTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108} {0: 1, 1: 0, 2: 5, 3: 58, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!