ID: 1077533572_1077533579

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1077533572 1077533579
Species Human (GRCh38) Human (GRCh38)
Location 11:3108356-3108378 11:3108373-3108395
Sequence CCCTGATGGCCACCCACAGGTTT AGGTTTCTGCAGGTGGAGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 145} {0: 1, 1: 0, 2: 4, 3: 21, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!