ID: 1077543564_1077543572

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1077543564 1077543572
Species Human (GRCh38) Human (GRCh38)
Location 11:3159094-3159116 11:3159110-3159132
Sequence CCAGCCACCCTCTGAACACAAGG CACAAGGGACAGCAGGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217} {0: 1, 1: 0, 2: 4, 3: 40, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!