ID: 1077561368_1077561373

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1077561368 1077561373
Species Human (GRCh38) Human (GRCh38)
Location 11:3263729-3263751 11:3263752-3263774
Sequence CCAAGCCCAAGCTGATGGAGAGG CAGAGCCTCAGTCCATCTCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!