ID: 1077574996_1077575008

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077574996 1077575008
Species Human (GRCh38) Human (GRCh38)
Location 11:3376198-3376220 11:3376244-3376266
Sequence CCATGGTTGCTGTGAGCAGTCTG TGGGAAGCACTAGCTAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 237} {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!