ID: 1077590568_1077590573

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1077590568 1077590573
Species Human (GRCh38) Human (GRCh38)
Location 11:3487803-3487825 11:3487824-3487846
Sequence CCATGTCTGGAGACAATTTTGGT GTTGTTGCGGCTGGAGGAGGTGG
Strand - +
Off-target summary No data {0: 4, 1: 10, 2: 3, 3: 41, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!