ID: 1077590568_1077590575

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077590568 1077590575
Species Human (GRCh38) Human (GRCh38)
Location 11:3487803-3487825 11:3487843-3487865
Sequence CCATGTCTGGAGACAATTTTGGT GTGGTGCTACTGGCAGCTAATGG
Strand - +
Off-target summary No data {0: 9, 1: 2, 2: 31, 3: 202, 4: 669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!