ID: 1077614816_1077614832

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077614816 1077614832
Species Human (GRCh38) Human (GRCh38)
Location 11:3667150-3667172 11:3667185-3667207
Sequence CCGCAGACCCAGGCCCTGTCGCG GGGGACCCCAGCGCATCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 265} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!