ID: 1077617328_1077617331

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1077617328 1077617331
Species Human (GRCh38) Human (GRCh38)
Location 11:3686665-3686687 11:3686686-3686708
Sequence CCTGTAAAACCACCATCACGATC TCAAGAAAATAAATAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 326} {0: 1, 1: 0, 2: 2, 3: 95, 4: 820}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!