ID: 1077617328_1077617333

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077617328 1077617333
Species Human (GRCh38) Human (GRCh38)
Location 11:3686665-3686687 11:3686694-3686716
Sequence CCTGTAAAACCACCATCACGATC ATAAATAGAGCAAGGCGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 326} {0: 1, 1: 0, 2: 9, 3: 138, 4: 1292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!