ID: 1077618330_1077618333

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1077618330 1077618333
Species Human (GRCh38) Human (GRCh38)
Location 11:3695885-3695907 11:3695902-3695924
Sequence CCTCAGCTACAAAATGGAGGAAA AGGAAAACAGCCCGGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 140, 4: 943} {0: 1, 1: 0, 2: 21, 3: 349, 4: 5637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!