|
Left Crispr |
Right Crispr |
| Crispr ID |
1077618330 |
1077618338 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:3695885-3695907
|
11:3695933-3695955
|
| Sequence |
CCTCAGCTACAAAATGGAGGAAA |
TGTAATCCCAGCACTCTGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 7, 3: 140, 4: 943} |
{0: 51, 1: 9692, 2: 312579, 3: 264031, 4: 147153} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|