|
Left Crispr |
Right Crispr |
| Crispr ID |
1077651349 |
1077651353 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:3975576-3975598
|
11:3975624-3975646
|
| Sequence |
CCACTGCATTCCAGATTGGGCAA |
AAGAAGAAGAAGAAGGAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 247, 2: 7660, 3: 89537, 4: 199407} |
{0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|