|
Left Crispr |
Right Crispr |
| Crispr ID |
1077651350 |
1077651353 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:3975586-3975608
|
11:3975624-3975646
|
| Sequence |
CCAGATTGGGCAACAAAGTGAGA |
AAGAAGAAGAAGAAGGAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 197, 2: 5418, 3: 48777, 4: 112821} |
{0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|