ID: 1077718103_1077718113

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1077718103 1077718113
Species Human (GRCh38) Human (GRCh38)
Location 11:4601146-4601168 11:4601183-4601205
Sequence CCTCAGGGCCAGGAGTCCCGGCT TTATCTTAGTACAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 648} {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!