ID: 1077727640_1077727644

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077727640 1077727644
Species Human (GRCh38) Human (GRCh38)
Location 11:4691427-4691449 11:4691454-4691476
Sequence CCTCACATTGAACCAGAATATAC CATGGTGACCAGAGTGGATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 120} {0: 1, 1: 1, 2: 1, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!