ID: 1077730319_1077730330

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1077730319 1077730330
Species Human (GRCh38) Human (GRCh38)
Location 11:4723068-4723090 11:4723118-4723140
Sequence CCATGCAGCTGTCACGGCATGTT CAGCTCGGACAGCTTGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104} {0: 1, 1: 10, 2: 14, 3: 28, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!