ID: 1077750979_1077750981

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077750979 1077750981
Species Human (GRCh38) Human (GRCh38)
Location 11:4969754-4969776 11:4969793-4969815
Sequence CCCAAGTAAAGTAAAATATGCTT CTGATAACTCAGAAGATACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 476} {0: 1, 1: 0, 2: 0, 3: 19, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!