ID: 1077760018_1077760026

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077760018 1077760026
Species Human (GRCh38) Human (GRCh38)
Location 11:5084737-5084759 11:5084772-5084794
Sequence CCATGGTCTTGGAGTGGTGATGG GTCAGAGAAAGAAGCCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!