ID: 1077777289_1077777294

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077777289 1077777294
Species Human (GRCh38) Human (GRCh38)
Location 11:5285559-5285581 11:5285597-5285619
Sequence CCAACGCTGAAAGTAGGAATCTA ATGCTAGGAGGGCCTCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135} {0: 1, 1: 0, 2: 1, 3: 17, 4: 1304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!