ID: 1077799790_1077799795

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077799790 1077799795
Species Human (GRCh38) Human (GRCh38)
Location 11:5526227-5526249 11:5526262-5526284
Sequence CCCTCTTACTCCATGCTCAAGGC CTTCATTAGCTTCTCTAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 216} {0: 1, 1: 0, 2: 2, 3: 17, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!