ID: 1077822958_1077822960

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077822958 1077822960
Species Human (GRCh38) Human (GRCh38)
Location 11:5768501-5768523 11:5768547-5768569
Sequence CCTGTGATAAACATACTAGTGCC TAAATGCAATTATCTTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77} {0: 1, 1: 0, 2: 4, 3: 49, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!