|
Left Crispr |
Right Crispr |
| Crispr ID |
1077827801 |
1077827804 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:5829961-5829983
|
11:5830002-5830024
|
| Sequence |
CCATCATTCTCAGCAAACTATCG |
CACCGTATGCTCTCACTCATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3934, 1: 8775, 2: 8908, 3: 5852, 4: 4489} |
{0: 3, 1: 158, 2: 5601, 3: 13584, 4: 6403} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|