ID: 1077828720_1077828728

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077828720 1077828728
Species Human (GRCh38) Human (GRCh38)
Location 11:5839415-5839437 11:5839446-5839468
Sequence CCACAGGCTGTAAAGGGTAGTGA GGATAGAGGGATTGGTTAATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 194, 4: 952} {0: 1, 1: 0, 2: 2, 3: 49, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!