ID: 1077864346_1077864359

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077864346 1077864359
Species Human (GRCh38) Human (GRCh38)
Location 11:6210617-6210639 11:6210664-6210686
Sequence CCCCTTCTGGAGGGGGCCCCAGA ATGATGATGAGATGGATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 261} {0: 1, 1: 0, 2: 4, 3: 61, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!