ID: 1077864732_1077864736

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1077864732 1077864736
Species Human (GRCh38) Human (GRCh38)
Location 11:6212605-6212627 11:6212622-6212644
Sequence CCTCTTGCCTCTAACATTCTGCC TCTGCCTAGATTTCTGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 278} {0: 1, 1: 0, 2: 0, 3: 20, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!